ID: 1141522816_1141522824

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1141522816 1141522824
Species Human (GRCh38) Human (GRCh38)
Location 16:84592784-84592806 16:84592822-84592844
Sequence CCAGCACGTTCGCCTTCAACAAG ACGGGTCATCCATTTGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39} {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!