ID: 1141535106_1141535113

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1141535106 1141535113
Species Human (GRCh38) Human (GRCh38)
Location 16:84673688-84673710 16:84673735-84673757
Sequence CCAAGCACGGGGCTATAAGTCAG CTGTCACGTGCACCTGGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 12, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!