ID: 1141538632_1141538644

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1141538632 1141538644
Species Human (GRCh38) Human (GRCh38)
Location 16:84700442-84700464 16:84700460-84700482
Sequence CCCCGCCGCGCCGGCCGGGGGAG GGGAGGCGGCCCGGGGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 259} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!