|
Left Crispr |
Right Crispr |
| Crispr ID |
1141568618 |
1141568625 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:84920639-84920661
|
16:84920674-84920696
|
| Sequence |
CCGACCATGTCATCTGGTCCCTG |
TTCATGAACTCCTGCTGCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 9, 3: 9, 4: 194} |
{0: 3, 1: 6, 2: 4, 3: 67, 4: 1173} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|