ID: 1141571084_1141571097

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1141571084 1141571097
Species Human (GRCh38) Human (GRCh38)
Location 16:84934025-84934047 16:84934071-84934093
Sequence CCAGGCTATCCGCCGCCCAGCCG TGCCTGCCTGGCGTGGCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!