ID: 1141587450_1141587452

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1141587450 1141587452
Species Human (GRCh38) Human (GRCh38)
Location 16:85044270-85044292 16:85044283-85044305
Sequence CCGCTGTGTGTGCAGGGACTCTA AGGGACTCTAGTCCCCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 132} {0: 1, 1: 0, 2: 11, 3: 74, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!