ID: 1141590095_1141590102

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1141590095 1141590102
Species Human (GRCh38) Human (GRCh38)
Location 16:85062755-85062777 16:85062787-85062809
Sequence CCCAAATGGTAGCACCGGGCTGG GGGACAGTGTGGCTCCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68} {0: 1, 1: 1, 2: 1, 3: 19, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!