ID: 1141597658_1141597669

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1141597658 1141597669
Species Human (GRCh38) Human (GRCh38)
Location 16:85107237-85107259 16:85107263-85107285
Sequence CCAGCTCTCACTCTACCTCCCGG CTGCATCTTTCCCACGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 327} {0: 1, 1: 0, 2: 5, 3: 11, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!