ID: 1141611259_1141611268

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1141611259 1141611268
Species Human (GRCh38) Human (GRCh38)
Location 16:85182322-85182344 16:85182342-85182364
Sequence CCAAGAAACCAGGCAGGCTCCAG CAGAGGATGGGAGGAGGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 385} {0: 1, 1: 0, 2: 10, 3: 101, 4: 823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!