ID: 1141652130_1141652140

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141652130 1141652140
Species Human (GRCh38) Human (GRCh38)
Location 16:85398337-85398359 16:85398368-85398390
Sequence CCCAGGGGTTAGAGCAGGCAAGA CCTCCTGAGCAGGAGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 26, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!