ID: 1141687855_1141687866

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1141687855 1141687866
Species Human (GRCh38) Human (GRCh38)
Location 16:85580524-85580546 16:85580562-85580584
Sequence CCATTTGAGACATGCCCCAGCGA CAGCCTCCTGTTGGGTCACAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!