ID: 1141689115_1141689125

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1141689115 1141689125
Species Human (GRCh38) Human (GRCh38)
Location 16:85586636-85586658 16:85586656-85586678
Sequence CCCGCGCCCCCCCGACTGCCGTG GTGCTCCATGGCTTCCCATGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!