ID: 1141694456_1141694458

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1141694456 1141694458
Species Human (GRCh38) Human (GRCh38)
Location 16:85613091-85613113 16:85613105-85613127
Sequence CCCGTCGGTGCGCGCGCGCGCGC CGCGCGCGCCTGTGTGTTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 25, 4: 155} {0: 1, 1: 0, 2: 5, 3: 23, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!