ID: 1141698641_1141698648

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1141698641 1141698648
Species Human (GRCh38) Human (GRCh38)
Location 16:85632458-85632480 16:85632483-85632505
Sequence CCTGAATACATGGCCAGGACTCA GCCTTTGGTGGCAAGTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 125} {0: 1, 1: 0, 2: 1, 3: 19, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!