ID: 1141700560_1141700569

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141700560 1141700569
Species Human (GRCh38) Human (GRCh38)
Location 16:85640218-85640240 16:85640249-85640271
Sequence CCGGGACTCATGGCTTCCCTGCC GCTCCCTTAACACCGGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 324} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!