ID: 1141702696_1141702704

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1141702696 1141702704
Species Human (GRCh38) Human (GRCh38)
Location 16:85649846-85649868 16:85649878-85649900
Sequence CCACCTGCTCATCATCAGGGCCT CTATCCCCAGAGGTGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 310} {0: 1, 1: 0, 2: 0, 3: 26, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!