ID: 1141707609_1141707613

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1141707609 1141707613
Species Human (GRCh38) Human (GRCh38)
Location 16:85676530-85676552 16:85676571-85676593
Sequence CCTGGCGGGGACACGTGGGCAGC GCAGCATGCTAGACACTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 168} {0: 1, 1: 1, 2: 1, 3: 23, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!