ID: 1141710622_1141710637

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1141710622 1141710637
Species Human (GRCh38) Human (GRCh38)
Location 16:85696889-85696911 16:85696933-85696955
Sequence CCCACGCCTCCTTGGGGGACCGG CCGGCTCCTGGGTTTGGCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!