ID: 1141728104_1141728111

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1141728104 1141728111
Species Human (GRCh38) Human (GRCh38)
Location 16:85803792-85803814 16:85803826-85803848
Sequence CCCGTGCTCTGTGACTCCTGAGT CTGCATTTGGGCTCCTAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 264} {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!