ID: 1141728106_1141728111

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1141728106 1141728111
Species Human (GRCh38) Human (GRCh38)
Location 16:85803808-85803830 16:85803826-85803848
Sequence CCTGAGTGCACGCTTCCTCTGCA CTGCATTTGGGCTCCTAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132} {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!