ID: 1141740262_1141740273

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1141740262 1141740273
Species Human (GRCh38) Human (GRCh38)
Location 16:85887048-85887070 16:85887077-85887099
Sequence CCTCCCACCAAACCATGACCAAC TCTCTGGGGACGCTGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!