ID: 1141743811_1141743815

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1141743811 1141743815
Species Human (GRCh38) Human (GRCh38)
Location 16:85912768-85912790 16:85912801-85912823
Sequence CCTTTGGCCAGCATCACTGTTCA AGAGCTTGTCTGCGTGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 165} {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!