ID: 1141790819_1141790826

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1141790819 1141790826
Species Human (GRCh38) Human (GRCh38)
Location 16:86232846-86232868 16:86232873-86232895
Sequence CCAACCCCAACCAGATGATAGAA TATTCCTGGTTCAAACCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!