ID: 1141806887_1141806901

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1141806887 1141806901
Species Human (GRCh38) Human (GRCh38)
Location 16:86347774-86347796 16:86347814-86347836
Sequence CCCACCCCCCACCCCAAAGGGGC CTCGCTTTCCCCACTGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 673} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!