ID: 1141811517_1141811524

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1141811517 1141811524
Species Human (GRCh38) Human (GRCh38)
Location 16:86379275-86379297 16:86379308-86379330
Sequence CCAGGGAAGCAGCCCACCAAGGG CGAAGTTGCAGCCCATCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!