ID: 1141829819_1141829828

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1141829819 1141829828
Species Human (GRCh38) Human (GRCh38)
Location 16:86503996-86504018 16:86504013-86504035
Sequence CCCAGTCCCATCTGTGCTAAGTG TAAGTGGGTGTGACAGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 172} {0: 1, 1: 0, 2: 2, 3: 14, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!