ID: 1141840139_1141840152

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1141840139 1141840152
Species Human (GRCh38) Human (GRCh38)
Location 16:86568616-86568638 16:86568667-86568689
Sequence CCACAGCGGGGACCTGAACCACC GCAAACTTTCCCCAACGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117} {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!