ID: 1141901474_1141901479

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1141901474 1141901479
Species Human (GRCh38) Human (GRCh38)
Location 16:86993922-86993944 16:86993944-86993966
Sequence CCTGACTTGCCACTGAACCCATG GCGCCCTGGACAACCTCCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!