ID: 1141910206_1141910211

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1141910206 1141910211
Species Human (GRCh38) Human (GRCh38)
Location 16:87053499-87053521 16:87053512-87053534
Sequence CCCCGGGGAGCACACTGCTGGCG ACTGCTGGCGGCAAGCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102} {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!