ID: 1141920506_1141920509

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1141920506 1141920509
Species Human (GRCh38) Human (GRCh38)
Location 16:87132599-87132621 16:87132613-87132635
Sequence CCAGCAGCCGGCTACATTTCTTG CATTTCTTGGACACCTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87} {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!