ID: 1141921802_1141921810

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1141921802 1141921810
Species Human (GRCh38) Human (GRCh38)
Location 16:87140469-87140491 16:87140508-87140530
Sequence CCACCGACTTTCCTCTTCCGGAG TCCATCGCTGTCCTTGGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82} {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!