ID: 1141922726_1141922736

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1141922726 1141922736
Species Human (GRCh38) Human (GRCh38)
Location 16:87146785-87146807 16:87146831-87146853
Sequence CCTGAATAGGTGTCCAAAGGGGA AGGGCCTGTCTCTTGAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 0, 2: 1, 3: 47, 4: 957}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!