ID: 1141939099_1141939108

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1141939099 1141939108
Species Human (GRCh38) Human (GRCh38)
Location 16:87262871-87262893 16:87262915-87262937
Sequence CCAGAGAGGTATCCTGCGCCAGC CATCAAAGGGATACCGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 0, 2: 0, 3: 6, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!