ID: 1141948965_1141948969

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1141948965 1141948969
Species Human (GRCh38) Human (GRCh38)
Location 16:87328481-87328503 16:87328503-87328525
Sequence CCACTCACACTCAGCAGTGGACA ACTTGAGGTCACGGCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 213} {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!