ID: 1141957644_1141957660

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1141957644 1141957660
Species Human (GRCh38) Human (GRCh38)
Location 16:87383382-87383404 16:87383423-87383445
Sequence CCCCGCCACCCCCGCGCGCTCAC TCCAGATGGTGTCGGTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 382} {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!