ID: 1141960820_1141960829

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1141960820 1141960829
Species Human (GRCh38) Human (GRCh38)
Location 16:87406862-87406884 16:87406897-87406919
Sequence CCTGCATGCTGGAAATGGCAGCC GTCGCACAGGACTCTCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 164} {0: 1, 1: 0, 2: 1, 3: 1, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!