ID: 1141961749_1141961756

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1141961749 1141961756
Species Human (GRCh38) Human (GRCh38)
Location 16:87413564-87413586 16:87413609-87413631
Sequence CCTGCCAGGTTTTTTTTTTTCCC TTTCTATTGTGAAGAAAACCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 184, 4: 1633} {0: 1, 1: 0, 2: 2, 3: 19, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!