ID: 1141961752_1141961756

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1141961752 1141961756
Species Human (GRCh38) Human (GRCh38)
Location 16:87413585-87413607 16:87413609-87413631
Sequence CCTCCTGAGCTACTGCTCCTCCG TTTCTATTGTGAAGAAAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162} {0: 1, 1: 0, 2: 2, 3: 19, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!