ID: 1141972430_1141972438

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1141972430 1141972438
Species Human (GRCh38) Human (GRCh38)
Location 16:87492711-87492733 16:87492728-87492750
Sequence CCGCCGCCCGCGCCTCCGCCCAG GCCCAGGCCGGCCGTTACCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 170, 4: 1322} {0: 1, 1: 1, 2: 0, 3: 6, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!