ID: 1141972435_1141972451

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1141972435 1141972451
Species Human (GRCh38) Human (GRCh38)
Location 16:87492718-87492740 16:87492754-87492776
Sequence CCGCGCCTCCGCCCAGGCCGGCC GCGGGCGCGGCGTCGCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 607} {0: 1, 1: 0, 2: 2, 3: 31, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!