ID: 1141972437_1141972453

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1141972437 1141972453
Species Human (GRCh38) Human (GRCh38)
Location 16:87492726-87492748 16:87492756-87492778
Sequence CCGCCCAGGCCGGCCGTTACCCC GGGCGCGGCGTCGCCGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115} {0: 1, 1: 0, 2: 3, 3: 23, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!