ID: 1141972441_1141972452

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1141972441 1141972452
Species Human (GRCh38) Human (GRCh38)
Location 16:87492730-87492752 16:87492755-87492777
Sequence CCAGGCCGGCCGTTACCCCGGGC CGGGCGCGGCGTCGCCGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 77} {0: 1, 1: 1, 2: 0, 3: 17, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!