ID: 1141972442_1141972457

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1141972442 1141972457
Species Human (GRCh38) Human (GRCh38)
Location 16:87492735-87492757 16:87492767-87492789
Sequence CCGGCCGTTACCCCGGGCCGCGG CGCCGCCTGGGGAGCGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 76} {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!