ID: 1141991244_1141991252

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1141991244 1141991252
Species Human (GRCh38) Human (GRCh38)
Location 16:87611632-87611654 16:87611677-87611699
Sequence CCCGCCTCTGTCTGCTGCTCTAT TGTTACAAGAACCACCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 458} {0: 1, 1: 0, 2: 2, 3: 12, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!