ID: 1141994943_1141994959

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1141994943 1141994959
Species Human (GRCh38) Human (GRCh38)
Location 16:87630383-87630405 16:87630435-87630457
Sequence CCCTCTCCCCTTGTCCTTCTGGG TCCCCAGCCAGTCCTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 527} {0: 1, 1: 0, 2: 7, 3: 39, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!