ID: 1141998625_1141998637

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1141998625 1141998637
Species Human (GRCh38) Human (GRCh38)
Location 16:87650368-87650390 16:87650408-87650430
Sequence CCCCCATCCCTCTCTCTCCTCTG GACACAACAGTATTAAAATTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 25, 3: 315, 4: 2385} {0: 6, 1: 76, 2: 381, 3: 659, 4: 862}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!