|
Left Crispr |
Right Crispr |
| Crispr ID |
1142000410 |
1142000424 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:87661153-87661175
|
16:87661203-87661225
|
| Sequence |
CCCTCCTCCACCTTCAGAGCCAG |
CCTCCTGCCTCCCTCTTACAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 35, 2: 254, 3: 602, 4: 1303} |
{0: 4, 1: 41, 2: 126, 3: 365, 4: 895} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|