ID: 1142008717_1142008723

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142008717 1142008723
Species Human (GRCh38) Human (GRCh38)
Location 16:87702646-87702668 16:87702664-87702686
Sequence CCACAGGGGCCTCTCTGCTCAGG TCAGGGGAGCCACGCGGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 42, 4: 402} {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!