ID: 1142009061_1142009068 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1142009061 | 1142009068 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16:87704517-87704539 | 16:87704535-87704557 |
| Sequence | CCTGGGGAGGGCCCTGGGGAGGG | GAGGGGTCCTGAACGTCACGGGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 3, 2: 23, 3: 165, 4: 1036} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||