ID: 1142009240_1142009244

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142009240 1142009244
Species Human (GRCh38) Human (GRCh38)
Location 16:87705347-87705369 16:87705367-87705389
Sequence CCCTGTGTTGTGTTCCGCGTCTC CTCCCACGGTTCCACACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 59} {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!